BioBricks in TinkerCell

A first attempt at storing a composite BioBrick

The BBa_I0462 is composed of 4 other sub-parts. Each part, including the composite part, has author, date, and other annotations. The sequence, however, is a property of each of the sub-parts, not the composite parts.

All this information is stored in this model object drawn in TinkerCell. Here is the Python code for accessing all the information (they can also be viewed through the visual interface).

>>part = tc_find("BBa_I0462")

>>print fromStrings( tc_annotation(part) )

('Caitlin Conboy and Jennifer Braff', '12/04/2003', 'luxR Protein Generator', 'uri', 'reference')

>>print tc_getTextAttribute(part,"format")

BBa

>>print tc_getTextAttribute(part,"type")

composite

>>subparts = fromItems( tc_getChildren(part) )

>>for i in subparts: print tc_getName(i) + " is a " + tc_getFamily(i);

BBa_I0462_B0012 is a Terminator

BBa_I0462_B0010 is a Terminator

BBa_I0462_C0062 is a Coding

BBa_I0462_B0034 is a RBS

>>for i in subparts: print tc_getName(i) + " : "; print fromStrings( tc_annotation(i) );

BBa_I0462_B0012 :

('Reshma Shetty', 'NA', 'Transcription terminator for the E.coli RNA polymerase.', 'uri', 'reference')

BBa_I0462_B0010 :

('Randy Rettberg', '11/19/2003', 'Transcriptional terminator consisting of a 64 bp stem-loop', 'uri', 'reference')

BBa_I0462_C0062 :

('Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr', '2003', 'luxR repressor/activator', 'uri', 'reference')

BBa_I0462_B0034 :

('Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr', '2003', 'RBS based on Elowitz repressilator', 'uri', 'reference')

>>for i in subparts: print getName(i) + " : "; print getTextAttribute(i,"sequence");

BBa_I0462_B0012 :

tcacactggctcaccttcgggtgggcctttctgcgtttata

BBa_I0462_B0010 :

ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc

BBa_I0462_C0062 :

aaagaggag ... ttctgcgtttata

BBa_I0462_B0034 :

aaagaggagaaa

>>print getParameter(subparts[3],"strength")

5.0